Stem-loop sequence mmu-mir-181d

Accession MI0005450
Symbol MGI:Mir181d
Description Mus musculus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
acaauua         g ug          guga  ag 
       acauucauu u  ucgguggguu    gg  g
       ||||||||| |  ||||||||||    ||   
       uguaaguag g  ggccacccag    cc  c
-ugucac         g --          ---a  ga 
Get sequence
Deep sequencing
766294 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 84178716-84178787 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-181d
mmu-mir-181c chr8: 84178873-84178961 [-]
mmu-mir-181d chr8: 84178716-84178787 [-]
Database links

Mature sequence mmu-miR-181d-5p

Accession MIMAT0004324
Previous IDs mmu-miR-181d
Sequence

7 - 

aacauucauuguugucggugggu

 - 29

Get sequence
Deep sequencing 729236 reads, 82 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-181d-3p

Accession MIMAT0017264
Previous IDs mmu-miR-181d*
Sequence

48 - 

cccaccgggggaugaauguca

 - 68

Get sequence
Deep sequencing 647 reads, 48 experiments
Evidence experimental; Solexa [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).