Stem-loop sequence mmu-mir-181d

AccessionMI0005450 (change log)
Symbol MGI:Mir181d
DescriptionMus musculus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

123 open access papers mention mmu-mir-181d
(652 sentences)

Stem-loop
   acaauua         g ug          guga  ag 
5'        acauucauu u  ucgguggguu    gg  g
          ||||||||| |  ||||||||||    ||   
3'        uguaaguag g  ggccacccag    cc  c
   -ugucac         g --          ---a  ga 
Get sequence
Deep sequencing
1430801 reads, 2.41e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 84178716-84178787 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-181d
mmu-mir-181cchr8: 84178873-84178961 [-]
mmu-mir-181dchr8: 84178716-84178787 [-]
Database links

Mature sequence mmu-miR-181d-5p

Accession MIMAT0004324
Previous IDsmmu-miR-181d
Sequence

7 - 

aacauucauuguugucggugggu

 - 29

Get sequence
Deep sequencing1429865 reads, 107 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-181d-3p

Accession MIMAT0017264
Previous IDsmmu-miR-181d*
Sequence

48 - 

cccaccgggggaugaauguca

 - 68

Get sequence
Deep sequencing918 reads, 69 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).