Stem-loop sequence ath-MIR870

AccessionMI0005448 (change log)
DescriptionArabidopsis thaliana miR870 stem-loop
Literature search

2 open access papers mention ath-MIR870
(2 sentences)

Stem-loop
             -            a    a      ac    a 
5' gaucgaagaa caucaaauuaga ugug ugcaaa  uuag c
   |||||||||| |||||||||||| |||| ||||||  ||||  
3' cuagcuucuu gugguuuaaucu acac acguuu  aauc u
             u            a    a      ac    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 21395545-21395629 [-]
intergenic
Database links

Mature sequence ath-miR870-5p

Accession MIMAT0032025
Sequence

6 - 

aagaacaucaaauuagaaugu

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ath-miR870-3p

Accession MIMAT0004322
Previous IDsath-miR870
Sequence

65 - 

uaauuugguguuucuucgauc

 - 85

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).