Stem-loop sequence ath-MIR869

AccessionMI0005447 (change log)
DescriptionArabidopsis thaliana miR869 stem-loop
Gene family MIPF0001167; MIR869
Stem-loop
               ga   c         g     a  a   c          u                 c  g        ua       c       -       c       cuauaa       a             ---c  u   u 
5' gcccaccauaca  uuu cauacggua aagaa gu uca cuaucucaac ccaggauuggaccagua ua gcucauca  guuaagc acaaucc acgauuc ucaucag      aagcaaa ccuucauaucuau    cu guu c
   ||||||||||||  ||| ||||||||| ||||| || ||| |||||||||| ||||||||||||||||| || ||||||||  ||||||| ||||||| ||||||| |||||||      ||||||| |||||||||||||    || |||  
3' cggguggugugu  aaa guaugccau uucuu ca agu gauagaguug ggucuuaacuugguuau au cgaguagu  caauucg uguuagg uguuagg aguaguc      uuuguuu ggaaguauagaua    ga caa u
               ac   a         a     -  c   u          u                 u  a        ca       u       g       a       ------       c             cucu  c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 15891579-15891873 [-]
intergenic
Database links

Mature sequence ath-miR869.1

Accession MIMAT0004320
Sequence

229 - 

auugguucaauucugguguug

 - 249

Get sequence
Evidence experimental; cloned [1]

Mature sequence ath-miR869.2

Accession MIMAT0004321
Sequence

240 - 

ucugguguugagauaguugac

 - 260

Get sequence
Evidence experimental; 454 [1], cloned [1], Illumina [2]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).