Stem-loop sequence ath-MIR868

AccessionMI0005446 (change log)
DescriptionArabidopsis thaliana miR868 stem-loop
Gene family MIPF0001173; MIR868
Stem-loop
      -u                      u  a     ----au    agcuau       c            u    a     g           gag 
5' gaa  aagcauugucggcacuugagaa gu aagug      gauc      cguauuu augucguaauag aguc cguua ggugauauaac   g
   |||  |||||||||||||||||||||| || |||||      ||||      ||||||| |||||||||||| |||| ||||| |||||||||||   c
3' cuu  uucguaauagucgugaauucuu ca uucac      uuag      gcauaaa uacaguauuauc uuag gugau cuacuauauug   g
      uc                      c  g     aaaauu    -guuuu       a            u    c     a           aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 6488234-6488426 [+]
intergenic
Database links

Mature sequence ath-miR868-5p

Accession MIMAT0020355
Sequence

54 - 

ucaugucguaauaguagucac

 - 74

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ath-miR868-3p

Accession MIMAT0004319
Previous IDsath-miR868
Sequence

166 - 

cuucuuaagugcugauaaugc

 - 186

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).