Stem-loop sequence ath-MIR845b

AccessionMI0005444 (change log)
DescriptionArabidopsis thaliana miR845b stem-loop
Gene family MIPF0000369; MIR845_1
Literature search

2 open access papers mention ath-MIR845b
(4 sentences)

Stem-loop
        --        ca        -gc         a    augau  au 
5' agucg  guuuccau  cgucaauu   uaucagagc acgc     gu  a
   |||||  ||||||||  ||||||||   ||||||||| ||||     ||   
3' uuagc  caaaggua  guaguuaa   auagucucg ugcg     ca  a
        ua        ac        acc         c    --aau  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 12214069-12214167 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR845b
ath-MIR845achr4: 12217406-12217568 [-]
ath-MIR845bchr4: 12214069-12214167 [-]
Database links

Mature sequence ath-miR845b

Accession MIMAT0004317
Sequence

61 - 

ucgcucugauaccaaauugaug

 - 82

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).