Stem-loop sequence ath-MIR866

AccessionMI0005443 (change log)
DescriptionArabidopsis thaliana miR866 stem-loop
Literature search

1 open access papers mention ath-MIR866
(1 sentences)

Stem-loop
       -c   u               a              u             --cc   aag 
5' ucau  uau cuuacuuuucaagga cggauuuuguuaac aaaugauucacac    uug   a
   ||||  ||| ||||||||||||||| |||||||||||||| |||||||||||||    |||    
3' agug  aua gaaugagaaguuucu gccuaaaacaauug uuuacuaagugug    agc   a
       uu   u               -              c             cucu   aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 16157823-16157948 [-]
intergenic
Database links

Mature sequence ath-miR866-5p

Accession MIMAT0004315
Sequence

18 - 

ucaaggaacggauuuuguuaa

 - 38

Get sequence
Evidence experimental; cloned [1]

Mature sequence ath-miR866-3p

Accession MIMAT0004316
Sequence

92 - 

acaaaauccgucuuugaaga

 - 111

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).