Stem-loop sequence ath-MIR864

AccessionMI0005441 (change log)
DescriptionArabidopsis thaliana miR864 stem-loop
Literature search

2 open access papers mention ath-MIR864
(2 sentences)

Stem-loop
         -     g        c     ----auaccuu      aua 
5' gcuuca gguau auugacuu aaaaa           gaaacu   a
   |||||| ||||| |||||||| |||||           ||||||   a
3' cgaagu ccaua uaacugaa uuuuu           cuuuga   c
         u     a        a     aguuuaaguuu      cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 6740500-6740591 [+]
intergenic
Database links

Mature sequence ath-miR864-5p

Accession MIMAT0004311
Sequence

4 - 

ucagguaugauugacuucaaa

 - 24

Get sequence
Evidence experimental; cloned [1]

Mature sequence ath-miR864-3p

Accession MIMAT0004312
Sequence

70 - 

uaaagucaauaauaccuugaag

 - 91

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).