Stem-loop sequence ath-MIR863

AccessionMI0005440 (change log)
DescriptionArabidopsis thaliana miR863 stem-loop
Literature search

2 open access papers mention ath-MIR863
(3 sentences)

Stem-loop
      auaag                       gggg           c             a       a      a  c                       a        u              gaa       aaca      ---     a 
5' cuc     auguagaaacuagagaagaguuu    gaaaacucuuu uuaugucuuguug ucucaau gcauug ua aauguauauauaugcaauuuaga uauguuuu ccuaauuugaauaa   auagaua    ugaaua   aguau u
   |||     |||||||||||||||||||||||    ||||||||||| ||||||||||||| ||||||| |||||| || ||||||||||||||||||||||| |||||||| ||||||||||||||   |||||||    ||||||   |||||  
3' gag     uacaucuuugaucuuuuuucaaa    cuuuugagaaa aauacagaacaac agaguua cguaac au uuguauauauauauguuggaucu auacaaag ggauuaaacuuauu   uauuuau    auuuau   uuaua a
      gagaa                       --ag           u             g       g      c  a                       a        u              ---       -aag      ccu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 7846597-7846899 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR863
ath-MIR5026chr4: 7844496-7844688 [+]
ath-MIR850chr4: 7845707-7845927 [+]
ath-MIR863chr4: 7846597-7846899 [+]
Database links

Mature sequence ath-miR863-5p

Accession MIMAT0004309
Sequence

48 - 

uuaugucuuguugaucucaau

 - 68

Get sequence
Evidence experimental; cloned [1]

Mature sequence ath-miR863-3p

Accession MIMAT0004310
Sequence

239 - 

uugagagcaacaagacauaau

 - 259

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).