Stem-loop sequence ath-MIR862

AccessionMI0005439 (change log)
DescriptionArabidopsis thaliana miR862 stem-loop
Gene family MIPF0001145; MIR862
Literature search

1 open access papers mention ath-MIR862
(2 sentences)

Stem-loop
               caa      g                      -aca  g 
5' acaguaguuuuc   uagguc agcaugugcugaaacugugugu    ga u
   ||||||||||||   |||||| ||||||||||||||||||||||    ||  
3' ugucaucagaag   aucuag ucguauacgacuuugacacaca    cu u
               uuc      g                      aaua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 10718096-10718198 [+]
intergenic
Database links

Mature sequence ath-miR862-5p

Accession MIMAT0004307
Sequence

11 - 

uccaauaggucgagcaugugc

 - 31

Get sequence
Evidence experimental; cloned [1], Illumina [2]

Mature sequence ath-miR862-3p

Accession MIMAT0004308
Sequence

75 - 

auaugcuggaucuacuugaag

 - 95

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).