Stem-loop sequence ath-MIR861

AccessionMI0005438 (change log)
DescriptionArabidopsis thaliana miR861 stem-loop
Gene family MIPF0001190; MIR861
Literature search

3 open access papers mention ath-MIR861
(3 sentences)

Stem-loop
               uc   c  u           a    g     au      cg    -  ug   a 
5' guaucauuguuu  gaa ga guccuuggaga auau cguca  ggaguc  ucuu cu  aga g
   ||||||||||||  ||| || ||||||||||| |||| |||||  ||||||  |||| ||  ||| c
3' caugguaacaaa  cuu cu caggaacuucu uaua guagu  ucuuag  agag ga  uuu a
               --   u  u           g    g     ac      ua    u  gu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 17838135-17838266 [-]
intergenic
Database links

Mature sequence ath-miR861-5p

Accession MIMAT0004305
Sequence

24 - 

ccuuggagaaauaugcgucaa

 - 44

Get sequence
Evidence experimental; 454 [1], cloned [1], Illumina [2]

Mature sequence ath-miR861-3p

Accession MIMAT0004306
Sequence

93 - 

gauggauaugucuucaaggac

 - 113

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).