Stem-loop sequence ath-MIR860

AccessionMI0005437 (change log)
DescriptionArabidopsis thaliana miR860 stem-loop
Gene family MIPF0001176; MIR860
Literature search

2 open access papers mention ath-MIR860
(5 sentences)

Stem-loop
     g             c                         g    a ua   --     cu 
5' au ucuugguuaaauu aauauauauaguccaaucuauugaa uacu g  cac  cagcu  a
   || ||||||||||||| ||||||||||||||||||||||||| |||| |  |||  |||||   
3' ua agaaucaguuuaa uuauauguaucagguuagauaacuu auga u  gug  gucga  a
     g             a                         g    a gg   ua     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 9098791-9098916 [+]
intergenic
Database links

Mature sequence ath-miR860

Accession MIMAT0004304
Sequence

86 - 

ucaauagauuggacuauguau

 - 106

Get sequence
Evidence experimental; 454 [1], cloned [1], Illumina [2]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).