Stem-loop sequence ath-MIR859

AccessionMI0005436 (change log)
DescriptionArabidopsis thaliana miR859 stem-loop
Gene family MIPF0001191; MIR859
Literature search

3 open access papers mention ath-MIR859
(5 sentences)

Stem-loop
                  a    c           gu             gaauuaacauua       u 
5' aaagguagaugucga aucu ucuguugugaa  caaacaugaguau            auggauc u
   ||||||||||||||| |||| |||||||||||  |||||||||||||            ||||||| u
3' uuucuaucugcagcu uaga agaugacacuu  guuuguacucaua            uacuuag u
                  a    u           ug             -----------a       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22149718-22149843 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR859
ath-MIR859chr1: 22149718-22149843 [+]
ath-MIR774achr1: 22149936-22150033 [+]
ath-MIR774bchr1: 22150128-22150266 [+]
Database links

Mature sequence ath-miR859

Accession MIMAT0004303
Sequence

18 - 

ucucucuguugugaagucaaa

 - 38

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).