Stem-loop sequence ath-MIR858a

AccessionMI0005435 (change log)
Previous IDsath-MIR858
DescriptionArabidopsis thaliana miR858 stem-loop
Gene family MIPF0001138; MIR858
Literature search

5 open access papers mention ath-MIR858a
(11 sentences)

Stem-loop
       ----  -uuu      -         cg    ug     g   ucuccuca     cuaauacgcgcuuuaucguuuauuucauucauccauc 
5' cuca    uc    guuucg uugucuguu  accu  gucuc auc        aaacc                                     c
   ||||    ||    |||||| |||||||||  ||||  ||||| |||        |||||                                      
3' gagu    ag    caaagc agcagauag  uggg  uaggg uag        uuugg                                     u
       cuuu  uuuu      u         -a    gu     g   --uuauug     cuauuugguacaugcaaucaaauacuacuaguauucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 26773539-26773725 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR858a
ath-MIR858achr1: 26773539-26773725 [-]
ath-MIR858bchr1: 26772633-26772935 [+]
Database links

Mature sequence ath-miR858a

Accession MIMAT0004302
Previous IDsath-miR858
Sequence

11 - 

uuucguugucuguucgaccuu

 - 31

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).