Stem-loop sequence ath-MIR857

AccessionMI0005434 (change log)
DescriptionArabidopsis thaliana miR857 stem-loop
Gene family MIPF0001180; MIR857
Literature search

5 open access papers mention ath-MIR857
(28 sentences)

Stem-loop
        c        caa       c             ga      cacccaaaa     ug     g   g            uuuaaaauagugacuuguuuuuuuuaaaauguuuuuuaagaauguuuuuucagcuuuuuauuuuauuuuaaaccuaaagguagcgugacuauuguggagaaaua 
5' uucga uccuacaa   acuuuca cauacaaaauaau  agaaaa         agguu  aaugu uga guuagucucauu                                                                                                        a
   ||||| ||||||||   ||||||| |||||||||||||  ||||||         |||||  ||||| ||| ||||||||||||                                                                                                         
3' aggcu aggauguu   uggaagu guauguuuuauug  ucuuuu         uuuaa  uuacg gcu caauuagaguaa                                                                                                        a
        a        aug       u             aa      -uuuagauc     gu     a   g            uuaucuuuuacagauauaaggcaaauuuuaucacuguaacaaaaauuuauauauaaaauuuuguuguagaaugauauuugguuuuuauaaaaaagaauacaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 7878185-7878561 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR857
ath-MIR841achr4: 7885251-7885462 [-]
ath-MIR5996chr4: 7882765-7882889 [-]
ath-MIR397bchr4: 7878652-7878760 [-]
ath-MIR857chr4: 7878185-7878561 [-]
Database links

Mature sequence ath-miR857

Accession MIMAT0004301
Sequence

344 - 

uuuuguauguugaagguguau

 - 364

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).