Stem-loop sequence ath-MIR856

AccessionMI0005433 (change log)
DescriptionArabidopsis thaliana miR856 stem-loop
Gene family MIPF0001162; MIR856
Literature search

4 open access papers mention ath-MIR856
(13 sentences)

Stem-loop
         aaga           u  c    auc    c          g    auca       --     a  -    c        ga          gua  g     u    u   -a        u  auuuua    c 
5' auguau    ggugagacugu gg uuua   cuac aauaacuuca cugc    ugaagag  uagac ga gauu uggcgguu  ggguuucuuc   ga guuga cgau cuu  auguccug gg      aguu c
   ||||||    ||||||||||| || ||||   |||| |||||||||| ||||    |||||||  ||||| || |||| ||||||||  ||||||||||   || ||||| |||| |||  |||||||| ||      |||| c
3' uacgua    cuauuuugaca cc aaau   ggug uuauugaagu gacg    auuucuc  aucug cu cuaa aucgccga  uccaaagaag   cu uaacu gcua gaa  uacaggau uc      ucaa a
         ----           c  a    -au    u          a    ----       ua     g  a    c        -g          aac  g     u    -   ca        -  --guug    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 11957460-11957730 [+]
intergenic
Database links

Mature sequence ath-miR856

Accession MIMAT0004300
Sequence

28 - 

uaauccuaccaauaacuucagc

 - 49

Get sequence
Evidence experimental; 454 [1], cloned [1]

References

1
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).