Stem-loop sequence cbr-mir-786

AccessionMI0005419 (change log)
DescriptionCaenorhabditis briggsae miR-786 stem-loop
Gene family MIPF0000363; mir-786
Stem-loop
        -c  uc     a       aa    u      uac   a  a 
5' gggac  cu  ccaac aaaucuc  auag ggcauu   aca gc a
   |||||  ||  ||||| |||||||  |||| ||||||   ||| ||  
3' cucug  ga  gguug uuuagag  uguc ccguaa   ugu ug u
        aa  gu     g       ca    -      ---   a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 13610815-13610905 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-786
cbr-mir-240chrX: 13610687-13610799 [+]
cbr-mir-786chrX: 13610815-13610905 [+]
Database links

Mature sequence cbr-miR-786

Accession MIMAT0004287
Sequence

55 - 

uaaugcccuguacgagauuuggu

 - 77

Get sequence
Evidence by similarity; MI0005186

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).