Stem-loop sequence cbr-mir-784

AccessionMI0005417 (change log)
DescriptionCaenorhabditis briggsae miR-784 stem-loop
Gene family MIPF0000999; mir-784
Stem-loop
         a     a     cc          -     aa 
5' cuacca guggc caaua  uguauguaga uagug  g
   |||||| ||||| |||||  |||||||||| |||||   
3' gguggu caccg guuau  acauacaucu guuau  u
         c     a     cc          u     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 13857294-13857370 [-]
intergenic
Database links

Mature sequence cbr-miR-784

Accession MIMAT0004285
Sequence

9 - 

uggcacaauaccuguauguaga

 - 30

Get sequence
Evidence by similarity; MI0005184

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).