Stem-loop sequence hsa-mir-675

AccessionMI0005416 (change log)
Symbol HGNC:MIR675
DescriptionHomo sapiens miR-675 stem-loop
Gene family MIPF0000365; mir-675
Literature search

106 open access papers mention hsa-mir-675
(877 sentences)

Stem-loop
          u    u    a      cc      gacu 
5' cccaggg cugg gcgg gagggc  acagug    u
   ||||||| |||| |||| ||||||  ||||||     
3' ggguccc gacu cgcc cucccg  ugucgc    g
          c    -    a      ua      agug 
Get sequence
Deep sequencing
2197 reads, 20.5 reads per million, 112 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 1996759-1996831 [-]
antisense
OTTHUMT00000314380 ; MRPL23-009; intron 5
ENST00000397297 ; MRPL23-009; intron 5
Database links

Mature sequence hsa-miR-675-5p

Accession MIMAT0004284
Previous IDshsa-miR-675
Sequence

10 - 

uggugcggagagggcccacagug

 - 32

Get sequence
Deep sequencing1092 reads, 84 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence hsa-miR-675-3p

Accession MIMAT0006790
Previous IDshsa-miR-675b;hsa-miR-675*
Sequence

45 - 

cuguaugcccucaccgcuca

 - 64

Get sequence
Deep sequencing1103 reads, 89 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
2
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).