Stem-loop sequence ath-MIR854d

AccessionMI0005415 (change log)
DescriptionArabidopsis thaliana miR854d stem-loop
Gene family MIPF0000361; MIR854
Literature search

5 open access papers mention ath-MIR854d
(19 sentences)

Stem-loop
       -----  a  auag            ugauacgagcauguaucauuucagugagcacguaccuccagcgcgggagagcaagagcuugagugaagcucacagaaacaaca 
5' cgga     ug gg    ggaggaggagua                                                                                   g
   ||||     || ||    ||||||||||||                                                                                   u
3' gccu     ac cc    ucuucucuucgu                                                                                   a
       uaucg  a  ---a            ugaauagaacaggcagucuuugcacuaccggaacuucgugaacuauucauuggauagaacaaagaacgugguggagacguuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 11689861-11690081 [-]
intergenic
Database links

Mature sequence ath-miR854d

Accession MIMAT0004283
Previous IDsath-miR854d;ath-miR854e
Sequence

3 - 

gaugaggauagggaggaggag

 - 23

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:17189346 "A family of microRNAs present in plants and animals" Arteaga-Vazquez M, Caballero-Perez J, Vielle-Calzada JP Plant Cell. 18:3355-3369(2006).