Stem-loop sequence ath-MIR854a

AccessionMI0005412 (change log)
DescriptionArabidopsis thaliana miR854a stem-loop
Gene family MIPF0000361; MIR854
Literature search

5 open access papers mention ath-MIR854a
(22 sentences)

       --u ag a   -          uaugauacgagcauguaucauuucagugagcacguaccuccagcgcgggagagcaagagcuugagugaagcucauagaaacaaca 
5' cgga   g  g uag ggaggaggag                                                                                     g
   ||||   |  | ||| ||||||||||                                                                                     u
3' gccu   c  c auc ucuucucuuc                                                                                     a
       uau ga -   a          gucgaauagaacaggcagucuuugcacuaccgaaacuucgugaacuauucaucggauagaacaaagaacgugguggagacguuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 11847719-11847939 [+]
Clustered miRNAs
< 10kb from ath-MIR854a
ath-MIR854cchr5: 11838096-11838316 [+]
ath-MIR854achr5: 11847719-11847939 [+]
Database links

Mature sequence ath-miR854a

Accession MIMAT0004280

3 - 


 - 23

Get sequence
Evidence experimental; Northern [1]


PMID:17189346 "A family of microRNAs present in plants and animals" Arteaga-Vazquez M, Caballero-Perez J, Vielle-Calzada JP Plant Cell. 18:3355-3369(2006).