Stem-loop sequence ath-MIR824

AccessionMI0005409 (change log)
DescriptionArabidopsis thaliana miR824 stem-loop
Gene family MIPF0000442; MIR824
Literature search

7 open access papers mention ath-MIR824
(25 sentences)

Stem-loop
   u         u  a   -----------    ug    u               u             uuuuguuuac     -  c -     g       a    uaaga      --au   - ---a       aacauagcuaguucgacauaccauacuacccuuuuuaaaacuauccuauauguuugaugcuagcauagcguaauuuuguguucucauggugcagcaggguuaguuuauuguguaccucuagauauauauucucuugcugcguaggguucccaagcugccaaaaacuuuuaaaaauuagugaucuguuccccaaacccccauucaauaagaaaggucuac 
5'  aucaccauu gu cuu           gagu  ucuc caugucuagaccauu gugagaagggagu          accaa ua c cccca ucucuaa uuug     aguauu    gcu c    auuaagg                                                                                                                                                                                                                           c
    ||||||||| || |||           ||||  |||| ||||||||||||||| |||||||||||||          ||||| || | ||||| ||||||| ||||     ||||||    ||| |    |||||||                                                                                                                                                                                                                           u
3'  uagugguaa ca gaa           cuca  ggag guguagaucugguag uacucuucccuua          ugguu gu g ggggu agggguu aaau     uuauaa    cga g    ugguucc                                                                                                                                                                                                                           g
   -         -  a   auggagguacu    gu    c               c             -------uau     u  a a     g       a    cuaug      gaau   u guac       acauuuacuaaaauauacuaaaacucuuagccgaaccugaucaagcuuauguuuauuuuuuucaauacauacguuguagaccuuuucaguacuuacuugaauuagcugaaugaagauauggauugaagacuuccuagucugaaaguaucccauugauuaauugauuuugucauuuggguuucuucguuccugucgagauuaucgacacugacacucgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 12625094-12625782 [+]
intergenic
Database links

Mature sequence ath-miR824-5p

Accession MIMAT0004277
Previous IDsath-miR824
Sequence

35 - 

uagaccauuugugagaaggga

 - 55

Get sequence
Evidence experimental; 454 [1-2], Northern [1,3], cloned [2], Illumina [4]

Mature sequence ath-miR824-3p

Accession MIMAT0032024
Sequence

628 - 

ccuucucaucgauggucuaga

 - 648

Get sequence
Evidence not experimental

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17704216 "MicroRNA-mediated regulation of stomatal development in Arabidopsis" Kutter C, Schob H, Stadler M, Meins F Jr, Si-Ammour A Plant Cell. 19:2417-2429(2007).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).