Stem-loop sequence ath-MIR853

AccessionMI0005408 (change log)
DescriptionArabidopsis thaliana miR853 stem-loop
Gene family MIPF0001182; MIR853
Literature search

1 open access papers mention ath-MIR853
(2 sentences)

Stem-loop
   gagaggaacaauuaggguuguuucaa         ----------   g   c            c  ua c   g   a    -            cucuucaaggaacuugugggccucaagaaaaccugcuauaauucuaguuuuucaacau 
5'                           acaggguaa          agu uuc ugcugcuccccu uu  g uug aga gcca guaaauaucuuu                                                          u
                             |||||||||          ||| ||| |||||||||||| ||  | ||| ||| |||| ||||||||||||                                                           
3'                           ugucccauu          uca aag acgacgagggga ag  c aac ucu cggu cauuuauagaaa                                                          c
   ---------uagacaaaaacuguuua         cccaauuuuc   -   u            a  gc -   g   c    u            cuccuucaagguaagagguaagaauucccauuccucaacaacgacuauagucuuccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 8346367-8346656 [+]
intergenic
Database links

Mature sequence ath-miR853

Accession MIMAT0004276
Sequence

50 - 

uccccucuuuagcuuggagaag

 - 71

Get sequence
Evidence experimental; 454 [1], cloned [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).