Stem-loop sequence ath-MIR852

AccessionMI0005407 (change log)
DescriptionArabidopsis thaliana miR852 stem-loop
Gene family MIPF0001126; MIR852
Literature search

2 open access papers mention ath-MIR852
(5 sentences)

Stem-loop
   uuuauccuaaacauccuauuaaguuuuuaugcugaaacaaagcucaaagc                                -g      --    g      cu 
5'                                                   ucagagcuaaggcgcuuaucuucuuugauauu  caugga  guau cuucua  u
                                                     ||||||||||||||||||||||||||||||||  ||||||  |||| ||||||   
3'                                                   agucuugauuccgcgaauagaagaaacuauaa  guauuu  cgua gaggau  c
   uggauuguuucuuauguuggaauacguaaaacacuuauuccgcgaauaga                                ag      ug    -      cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 8336166-8336373 [+]
intergenic
Database links

Mature sequence ath-miR852

Accession MIMAT0004275
Sequence

137 - 

aagauaagcgccuuaguucug

 - 157

Get sequence
Evidence experimental; 454 [1-2], cloned [2], Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).