Stem-loop sequence ath-MIR851

AccessionMI0005406 (change log)
DescriptionArabidopsis thaliana miR851 stem-loop
Gene family MIPF0001168; MIR851
Literature search

3 open access papers mention ath-MIR851
(4 sentences)

Stem-loop
   uuuucuuucuuuuccuuuucguuugauuuuggaaagca     c        cg   c  g       a   au        ga    a g 
5'                                       aggga ugucgucu  guu gc auccaca gua  cuuuugug  gauu u a
                                         ||||| ||||||||  ||| || ||||||| |||  ||||||||  |||| |  
3'                                       ucccu acagcaga  caa cg ugggugu cau  gagagcac  cuaa a a
   ucaaguguacuauaaaguucaagacuaccuugaccuua     a        aa   a  g       g   cg        ua    c a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 19659532-19659715 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR851
ath-MIR851chr3: 19659532-19659715 [-]
ath-MIR771chr3: 19659301-19659413 [-]
Database links

Mature sequence ath-miR851-5p

Accession MIMAT0004273
Sequence

50 - 

ucucgguucgcgauccacaag

 - 70

Get sequence
Evidence experimental; 454 [1-2], cloned [2]

Mature sequence ath-miR851-3p

Accession MIMAT0004274
Sequence

119 - 

uggguggcaaacaaagacgac

 - 139

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).