Stem-loop sequence ath-MIR850

AccessionMI0005405 (change log)
DescriptionArabidopsis thaliana miR850 stem-loop
Literature search

2 open access papers mention ath-MIR850
(5 sentences)

Stem-loop
   u    g     g        uua     ---ua  -ua       c g     u     c  g  u     a   cac  c      acuaua            aaucaa    u 
5'  uuua auagu uuauguau   uuucu     cc   uagaaac u ucagc aagau cg ac acaac aag   gu uacucu      uucuuuugcgau      uaga u
    |||| ||||| ||||||||   |||||     ||   ||||||| | ||||| ||||| || || ||||| |||   || ||||||      ||||||||||||      ||||  
3'  aagu uauca aauacaug   aaaga     gg   aucuuug a aguug uucua gc ug uguug uuc   ca augaga      aaggaaaugcua      aucu c
   -    a     a        ---     uacac  uaa       a g     u     u  -  c     a   aua  u      aaacag            ----ca    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 7845707-7845927 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR850
ath-MIR5026chr4: 7844496-7844688 [+]
ath-MIR850chr4: 7845707-7845927 [+]
ath-MIR863chr4: 7846597-7846899 [+]
Database links

Mature sequence ath-miR850

Accession MIMAT0004272
Sequence

50 - 

uaagauccggacuacaacaaag

 - 71

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).