Stem-loop sequence ath-MIR848

AccessionMI0005403 (change log)
DescriptionArabidopsis thaliana miR848 stem-loop
Gene family MIPF0001140; MIR848
Literature search

2 open access papers mention ath-MIR848
(3 sentences)

Stem-loop
   aaaacuuuca a    -  a   -   uau   -aaa  au     ---        a      -    a            u    aaa   a       cca 
5'           g uugc ac aga gaa   gaa    gu  uaaca   caagccuu uagcuu ggca ucucaugucaaa aagg   aga gaggaac   a
             | |||| || ||| |||   |||    ||  |||||   |||||||| |||||| |||| |||||||||||| ||||   ||| |||||||   g
3'           c aacg ug uuu cuu   cuu    ca  auugu   guucggaa aucgaa ccgu aggguacaguuu uucc   ucu cucuuug   g
   ----auuuca c    c  c   a   --u   ccua  cu     acc        -      u    c            c    --a   a       uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 4479397-4479591 [-]
intergenic
Database links

Mature sequence ath-miR848

Accession MIMAT0004270
Sequence

123 - 

ugacaugggacugccuaagcua

 - 144

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).