Stem-loop sequence ath-MIR846

AccessionMI0005402 (change log)
DescriptionArabidopsis thaliana miR846 stem-loop
Gene family MIPF0001189; MIR846
Literature search

4 open access papers mention ath-MIR846
(12 sentences)

Stem-loop
   -caaa   --c      ---   uu  -ggu   u        ugccac   c   u c       g     u         a   u   u     c   a  a  u            u     c    a         auucaagggacaaaaaaucauugggauauaugauuaugacaaacac 
5'      cau   uugaau   ccg  ga    uga cacgauga      auc ggu u auucaag acuuc auucagaac aac uca gauuu uga cu au ggauaugauaaa gguaa aagu uucacuugc                                              g
        |||   ||||||   |||  ||    ||| ||||||||      ||| ||| | ||||||| ||||| ||||||||| ||| ||| ||||| ||| || || |||||||||||| ||||| |||| |||||||||                                               
3'      gua   agcuua   ggc  cu    gcu guguuauu      uag cca a uaaguuc ugaag uaaguuuug uug agu cugaa gcu ga ua ccuauacuauuu ucauu uuca aggugaacg                                              a
   aacca   auc      aau   -c  augu   c        ------   a   c u       g     u         a   u   u     a   c  c  c            -     c    a         ucuaguaauagggugacgaacggagggcguugguaagucgaagguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22577375-22577733 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR846
ath-MIR842chr1: 22577067-22577265 [+]
ath-MIR846chr1: 22577375-22577733 [+]
Database links

Mature sequence ath-miR846-5p

Accession MIMAT0032023
Sequence

52 - 

cauucaaggacuucuauucag

 - 72

Get sequence
Evidence not experimental

Mature sequence ath-miR846-3p

Accession MIMAT0004269
Previous IDsath-miR846
Sequence

288 - 

uugaauugaagugcuugaauu

 - 308

Get sequence
Evidence experimental; 454 [1], Northern [1], cloned [2], Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).