Stem-loop sequence ath-MIR845a

AccessionMI0005401 (change log)
DescriptionArabidopsis thaliana miR845a stem-loop
Gene family MIPF0000369; MIR845_1
Literature search

3 open access papers mention ath-MIR845a
(5 sentences)

Stem-loop
   -------agau      uu     auu  --u    aguucc    cugc        ca         c          a   cu  g 
5'            aaggga  gcacg   uc   caau      gucg    guuuccau  cgucgauug ugucagagcc cgc  au a
              ||||||  |||||   ||   ||||      ||||    ||||||||  ||||||||| |||||||||| |||  || a
3'            uuuccu  ugugc   ag   guua      uagc    caaaggua  guaguuaac auagucucgg gug  ua g
   uguuguuccau      -u     cuu  ucc    ------    --ua        uc         c          c   uu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 12217406-12217568 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR845a
ath-MIR845achr4: 12217406-12217568 [-]
ath-MIR845bchr4: 12214069-12214167 [-]
Database links

Mature sequence ath-miR845a

Accession MIMAT0004268
Sequence

92 - 

cggcucugauaccaauugaug

 - 112

Get sequence
Evidence experimental; 454 [1-2], cloned [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).