Stem-loop sequence ath-MIR842

AccessionMI0005398 (change log)
DescriptionArabidopsis thaliana miR842 stem-loop
Gene family MIPF0001158; MIR842
Literature search

3 open access papers mention ath-MIR842
(8 sentences)

Stem-loop
   caguaccguucagggugacagaaacauuuucgaaaa      c      c         a   c               gca  aa  ua  u ug   u 
5'                                     gagagg uauaag gggaugaug auc gaccaugaugguguu   ga  uu  ug a  aug a
                                       |||||| |||||| ||||||||| ||| |||||||||||||||   ||  ||  || |  |||  
3'                                     uucuuu guauuc cccuacugc uag cugguacuaccacaa   cu  ag  ac u  uau g
   cucgaagugaaaaguuaacagguauaaacaacugga      u      a         c   a               -ag  --  gg  c gu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22577067-22577265 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR842
ath-MIR842chr1: 22577067-22577265 [+]
ath-MIR846chr1: 22577375-22577733 [+]
Database links

Mature sequence ath-miR842

Accession MIMAT0004264
Sequence

128 - 

ucauggucagauccgucaucc

 - 148

Get sequence
Evidence experimental; 454 [1-2], cloned [2], Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).