Stem-loop sequence ath-MIR841a

AccessionMI0005397 (change log)
Previous IDsath-MIR841
DescriptionArabidopsis thaliana miR841 stem-loop
Gene family MIPF0001112; MIR841
Literature search

6 open access papers mention ath-MIR841a
(9 sentences)

Stem-loop
   g      ca u       -gc   a      u    a      u           g     u    c     g           caauaucaguauaaaauuuuau 
5'  caccaa  c acuaugu   aga acucug ucuu aguugc ugugaauacga ccacu gaaa ugaaa aaacaaagaaa                      c
    ||||||  | |||||||   ||| |||||| |||| |||||| ||||||||||| ||||| |||| ||||| |||||||||||                       
3'  gugguu  g ugguaca   ucu ugagau agaa ucaacg acacuuaugcu gguga cuuu acuuu uuuguuucuuu                      a
   -      ca c       aca   a      c    c      u           g     u    a     a           aaaguaaaaaacaucauauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 7885251-7885462 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR841a
ath-MIR3932bchr4: 7890570-7890719 [-]
ath-MIR841achr4: 7885251-7885462 [-]
ath-MIR5996chr4: 7882765-7882889 [-]
ath-MIR397bchr4: 7878652-7878760 [-]
ath-MIR857chr4: 7878185-7878561 [-]
Database links

Mature sequence ath-miR841a-5p

Accession MIMAT0004263
Previous IDsath-miR841a
Sequence

50 - 

uacgagccacuugaaacugaa

 - 70

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence ath-miR841a-3p

Accession MIMAT0032022
Sequence

147 - 

auuucuagugggucguauuca

 - 167

Get sequence
Evidence not experimental

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).