Stem-loop sequence ath-MIR840

AccessionMI0005396 (change log)
DescriptionArabidopsis thaliana miR840 stem-loop
Gene family MIPF0001129; MIR840
Stem-loop
   ---      g   guga    -     u    uuuacauc   a          c     a          u            c  c   g       gg   ua  c    uuu 
5'    cguaaa cag    uuca ccaau uagg        cac guguggaaga acuga ggaccuaaac aacaaagguaaa gg uca ugugcgg  uau  ca ucgg   a
      |||||| |||    |||| ||||| ||||        ||| |||||||||| ||||| |||||||||| |||||||||||| || ||| |||||||  |||  || ||||    
3'    guauuu guc    gagu gguua gucc        gug cauaucuucu ugauu ccuggauuug uuguuucuauuu uc agu gcacgcc  aua  gu aguc   a
   cca      g   ----    a     u    uaaccuaa   c          u     c          u            c  u   a       ua   gc  a    ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 771337-771562 [-]
intergenic
Database links

Mature sequence ath-miR840-5p

Accession MIMAT0004262
Previous IDsath-miR840
Sequence

50 - 

acacugaaggaccuaaacuaac

 - 71

Get sequence
Evidence experimental; 454 [1-2], cloned [2]

Mature sequence ath-miR840-3p

Accession MIMAT0032021
Sequence

158 - 

uuguuuaggucccuuaguuuc

 - 178

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).