Stem-loop sequence ath-MIR838

AccessionMI0005394 (change log)
DescriptionArabidopsis thaliana miR838 stem-loop
Gene family MIPF0001184; MIR838
Literature search

3 open access papers mention ath-MIR838
(12 sentences)

Stem-loop
   ---uacuuuucuaauaucac        ac          guc    g   u             g     c      u    a     ----    aga      cu 
5'                     gaggacuu  auggccucaa   accu ugg guugugcaagaag agaag aaaguc gucu uguau    uaug   uagcua  u
                       ||||||||  ||||||||||   |||| ||| ||||||||||||| ||||| |||||| |||| |||||    ||||   ||||||   
3'                     cuucugaa  uaucggaguu   ugga guc caacacguucuuc ucuuc uuucgg caga acaug    auau   aucggu  c
   auuauuuauuguaauaucuu        ca          -au    -   -             a     u      c    -     uugu    agg      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 28500-28706 [+]
intergenic
Database links

Mature sequence ath-miR838

Accession MIMAT0004260
Sequence

136 - 

uuuucuucuacuucuugcaca

 - 156

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).