Stem-loop sequence ath-MIR837

AccessionMI0005393 (change log)
DescriptionArabidopsis thaliana miR837 stem-loop
Gene family MIPF0001155; MIR837
Literature search

2 open access papers mention ath-MIR837
(3 sentences)

Stem-loop
   u            c         c                a           u         c             a       uuuu   uu 
5'  uuuugauaaaua uuuuguuug uuacaaguauaaaguc ucauguuuuuu caucaguuu uuguucguuucaa auuauga    ugu  a
    |||||||||||| ||||||||| |||||||||||||||| ||||||||||| ||||||||| ||||||||||||| |||||||    |||   
3'  aagauuauuuau aaaauaaau aauguucauauuucag aguacaaaaag guagucaaa aacaagcaaaguu uaauacu    aca  c
   a            a         a                g           -         a             c       ---c   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 6520941-6521124 [+]
intergenic
Database links

Mature sequence ath-miR837-5p

Accession MIMAT0004258
Sequence

55 - 

aucaguuucuuguucguuuca

 - 75

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence ath-miR837-3p

Accession MIMAT0004259
Sequence

113 - 

aaacgaacaaaaaacugaugg

 - 133

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).