Stem-loop sequence ath-MIR834

AccessionMI0005390 (change log)
DescriptionArabidopsis thaliana miR834 stem-loop
Gene family MIPF0001183; MIR834
Literature search

2 open access papers mention ath-MIR834
(10 sentences)

Stem-loop
   uacaacauauguuaccaguugugcuaucauuuuuuucagcgacagccaaaauc         u       g   a     a    uccuuuuaaccguu     cacc        g ---    -ca  a  a 
5'                                                      accaccgcu cugcuac aac uguua gcca              gcugc    acuauuac g   ccau   ca ga a
                                                        ||||||||| ||||||| ||| ||||| ||||              |||||    |||||||| |   ||||   || ||  
3'                                                      ugguggcga gacgaug uug acagu uggu              cgacg    ugauagug c   ggug   gu cu a
   acugacgaagacuguggugguuacgaagguaacggcgagugcgauagccguaa         u       g   c     a    --------------     ---a        g aaa    aac  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 2641426-2641674 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR834
ath-MIR834chr5: 2641426-2641674 [-]
ath-MIR162achr5: 2634905-2635044 [-]
Database links

Mature sequence ath-miR834

Accession MIMAT0004254
Sequence

178 - 

ugguagcaguagcggugguaa

 - 198

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).