Stem-loop sequence ath-MIR833a

AccessionMI0005389 (change log)
Previous IDsath-MIR833
DescriptionArabidopsis thaliana miR833 stem-loop
Gene family MIPF0001186; MIR833
Literature search

2 open access papers mention ath-MIR833a
(3 sentences)

Stem-loop
   ----  ac    a  guac     c     g    c     a          g             u  -                  aa    c  u 
5'     gg  guag ug    ucuua agaug ugau gugaa acaaacggag aguuuguuuguug ac ucggucuaguucaaacca  acau uu g
       ||  |||| ||    ||||| ||||| |||| ||||| |||||||||| ||||||||||||| || ||||||||||||||||||  |||| ||  
3'     cc  cguc gc    agaau ucuac acua cacuu uguuugcuuc ucgaacaaacaac ug agccagaucgaguuuggu  ugua aa c
   cuca  -a    -  --aa     u     a    c     a          g             -  u                  -a    u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 29525151-29525337 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR833a
ath-MIR833achr1: 29525151-29525337 [+]
ath-MIR833bchr1: 29525202-29525286 [-]
Database links

Mature sequence ath-miR833a-5p

Accession MIMAT0004252
Previous IDsath-miR833-5p
Sequence

54 - 

uguuuguuguacucggucuagu

 - 75

Get sequence
Evidence experimental; 454 [1-2], cloned [2]

Mature sequence ath-miR833a-3p

Accession MIMAT0004253
Previous IDsath-miR833-3p
Sequence

115 - 

uagaccgaugucaacaaacaag

 - 136

Get sequence
Evidence experimental; 454 [1-2], cloned [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).