Stem-loop sequence ath-MIR830

AccessionMI0005386 (change log)
DescriptionArabidopsis thaliana miR830 stem-loop
Literature search

1 open access papers mention ath-MIR830
(1 sentences)

Stem-loop
   cagagucucgcuagugucuuuacuaaacacaa  uc     a   -  -  a  u c       c        u      g   acauauaauaau  a 
5'                                 aa  uguaa cgc cu cg uc c ucuucuc aaauaguu agguua cug            uc a
                                   ||  ||||| ||| || || || | ||||||| |||||||| |||||| |||            ||  
3'                                 uu  acauu gcg ga gc ag g agaagag uuuaucaa uccaau gac            ag u
   --gcuacaagaaguuuuaaguucgugagagga  ga     a   a  a  a  u a       u        -      a   cucuuugacccc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 4820355-4820549 [-]
intergenic
Database links

Mature sequence ath-miR830-5p

Accession MIMAT0004247
Previous IDsath-miR830*
Sequence

56 - 

ucuucuccaaauaguuuagguu

 - 77

Get sequence
Evidence experimental; cloned [2]

Mature sequence ath-miR830-3p

Accession MIMAT0004248
Previous IDsath-miR830
Sequence

124 - 

uaacuauuuugagaagaagug

 - 144

Get sequence
Evidence experimental; 454 [1-2], cloned [2], Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).