|
miRBase |
|
Stem-loop sequence ath-MIR830 |
|||||
| Accession | MI0005386 | ||||
| Description | Arabidopsis thaliana miR830 stem-loop | ||||
| Stem-loop |
cagagucucgcuagugucuuuacuaaacacaa uc a - - a u c c u g acauauaauaau a aa uguaa cgc cu cg uc c ucuucuc aaauaguu agguua cug uc a || ||||| ||| || || || | ||||||| |||||||| |||||| ||| || uu acauu gcg ga gc ag g agaagag uuuaucaa uccaau gac ag u --gcuacaagaaguuuuaaguucgugagagga ga a a a a u a u - a cucuuugacccc a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence ath-miR830-5p |
|
| Accession | MIMAT0004247 |
| Previous IDs | ath-miR830* |
| Sequence |
56 - ucuucuccaaauaguuuagguu - 77 |
| Deep sequencing | 14 reads, 3 experiments |
| Evidence | experimental; cloned [2] |
Mature sequence ath-miR830-3p |
|
| Accession | MIMAT0004248 |
| Previous IDs | ath-miR830 |
| Sequence |
124 - uaacuauuuugagaagaagug - 144 |
| Deep sequencing | 65 reads, 6 experiments |
| Evidence | experimental; 454 [1-2], cloned [2], Solexa [3] |
References |
|
| 1 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
| 2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
| 3 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|