Stem-loop sequence ath-MIR829

AccessionMI0005385 (change log)
DescriptionArabidopsis thaliana miR829 stem-loop
Gene family MIPF0001142; MIR829
Literature search

5 open access papers mention ath-MIR829
(11 sentences)

Stem-loop
   acgucaaaauugauuaacaaaaagucaaugaauca    a    -u     ug                     ac      a         a      uaa 
5'                                    uucu ccaa  ugacu  uacuuugaagcuuugauuuga  cuguca uugguauca agcuuc   a
                                      |||| ||||  |||||  |||||||||||||||||||||  |||||| ||||||||| ||||||   u
3'                                    gaga gguu  acuga  auggaacuucgaaauuaaacu  gguagu aaccauagu ucgaag   c
   -uaguucuaccauuugagcuucacgaaaaagaaaa    c    cu     ug                     aa      a         c      uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 11834022-11834226 [-]
intergenic
Database links

Mature sequence ath-miR829-5p

Accession MIMAT0032019
Sequence

54 - 

acuuugaagcuuugauuugaa

 - 74

Get sequence
Evidence experimental; Illumina [4]

Mature sequence ath-miR829-3p.1

Accession MIMAT0004245
Previous IDsath-miR829.1
Sequence

110 - 

agcucugauaccaaaugauggaau

 - 133

Get sequence
Evidence experimental; 454 [1], Illumina [3]

Mature sequence ath-miR829-3p.2

Accession MIMAT0004246
Previous IDsath-miR829.2
Sequence

134 - 

caaauuaaagcuucaagguag

 - 154

Get sequence
Evidence experimental; 454 [1-2], cloned [2], Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
4
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).