Stem-loop sequence ath-MIR826a

AccessionMI0005382 (change log)
Previous IDsath-MIR826
DescriptionArabidopsis thaliana miR826 stem-loop
Literature search

3 open access papers mention ath-MIR826a
(21 sentences)

Stem-loop
   agagacguggaugcuucucguccacaaguucuuu   -  cuc     u      c                   --------     u  ua 
5'                                   ggu gc   uauga auaguc gguuuuggauacgugaaaa        ucaua ca  u
                                     ||| ||   ||||| |||||| |||||||||||||||||||        ||||| ||   
3'                                   ucg cg   auacu uauuag ccaaaaccugugcacuuuu        agugu gu  u
   cauucucaucguccuuuuucuacuauucuaugug   u  -uu     c      a                   aauugaaa     c  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 1340479-1340656 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR826a
ath-MIR826achr4: 1340479-1340656 [+]
ath-MIR826bchr4: 1340521-1340614 [-]
Database links

Mature sequence ath-miR826a

Accession MIMAT0004242
Previous IDsath-miR826
Sequence

50 - 

uaguccgguuuuggauacgug

 - 70

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).