Stem-loop sequence ath-MIR825

AccessionMI0005381 (change log)
DescriptionArabidopsis thaliana miR825 stem-loop
Gene family MIPF0001178; MIR825
Literature search

2 open access papers mention ath-MIR825
(2 sentences)

Stem-loop
   cuuucuauaauuacuuuuuguauagaauucacuaguugauuc        c     a     ag  c  a     u     aa     cu a 
5'                                           caucgacu guuca gcacc  cu ga gaagc uagcu  uuuau  u g
                                             |||||||| ||||| |||||  || || ||||| |||||  |||||  | a
3'                                           guaguuga caagu cgugg  ga cu cuucg aucga  aagua  a a
   guguacacucuagguuaaaaccagaaauguguaguuuuauau        a     a     aa  a  -     u     aa     au a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 11159660-11159845 [+]
intergenic
Database links

Mature sequence ath-miR825

Accession MIMAT0004241
Sequence

115 - 

uucucaagaaggugcaugaac

 - 135

Get sequence
Evidence experimental; 454 [1], cloned [2]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).