Stem-loop sequence ath-MIR823

AccessionMI0005380 (change log)
DescriptionArabidopsis thaliana miR823 stem-loop
Gene family MIPF0001135; MIR823
Literature search

2 open access papers mention ath-MIR823
(3 sentences)

Stem-loop
   aauuucagagauacuaauccaagagauggcggauacguuuuacaauc  g                  a          aau  ga  -     a 
5'                                                ac aaucuuguaugaucacua ccauuggaac   aa  gu auaua u
                                                  || |||||||||||||||||| ||||||||||   ||  || ||||| g
3'                                                ug uuagaauauacuaguggu ggugaucuug   uu  ca uauau a
   cugauuaauuaggguuaucuacccccuauacaaagugacaaugguaa  g                  g          -au  ac  c     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 4496775-4496965 [-]
intergenic
Database links

Mature sequence ath-miR823

Accession MIMAT0004240
Sequence

120 - 

uggguggugaucauauaagau

 - 140

Get sequence
Evidence experimental; 454 [1-2], Northern [1], cloned [2], Illumina [3]

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).