Stem-loop sequence ath-MIR822

AccessionMI0005379 (change log)
DescriptionArabidopsis thaliana miR822 stem-loop
Gene family MIPF0001199; MIR822
Literature search

4 open access papers mention ath-MIR822
(6 sentences)

Stem-loop
   ----           a        uaua             c             cg                    cg     a         c   cc           a           -       a   ucguac             auguuaaugucauaaacuuua 
5'     cgaccuuaagu uaaguaga    uggggauguaacg auguuguuuucug  ggaagcauuugcacauguuu  uggag augaaauca auu  auacaugaaua uaauuaccuuu uagauag aca      ugcuugaaaaaac                     u
       ||||||||||| ||||||||    ||||||||||||| |||||||||||||  ||||||||||||||||||||  ||||| ||||||||| |||  ||||||||||| ||||||||||| ||||||| |||      |||||||||||||                      
3'     gcuggaauuca auucaucu    accccuacguugc uauaacaaaggac  cuuucguaaacguguacaaa  accuc uauuuuagu uaa  uauguacuuau auuaauggaag aucuauc ugu      acgaacuuuuuug                     g
   uguu           c        ----             a             au                    au     c         a   aa           c           u       g   ------             cgaaaaauauccacaaaagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 897020-897356 [-]
intergenic
Database links

Mature sequence ath-miR822-5p

Accession MIMAT0004239
Previous IDsath-miR822
Sequence

50 - 

ugcgggaagcauuugcacaug

 - 70

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence ath-miR822-3p

Accession MIMAT0032018
Sequence

270 - 

ugugcaaaugcuuucuacagg

 - 290

Get sequence
Evidence not experimental

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).