Stem-loop sequence bmo-mir-31

AccessionMI0005377 (change log)
DescriptionBombyx mori miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

5 open access papers mention bmo-mir-31
(79 sentences)

Stem-loop
   ------------------------guc          -c    aa   aa     c           uugaa 
5'                            gagccggugg  uggg  ggc  gaagu ggcauagcugu     u
                              ||||||||||  ||||  |||  ||||| |||||||||||     a
3'                            uucggccgcc  acuc  ccg  cuuca cugugucggca     a
   ucguaggcguuuagaacuuuaacuucu          ua    ga   ag     -           cauag 
Get sequence
Deep sequencing
17838 reads, 3.03e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581778.1: 423738-423858 [+]
intergenic
Database links

Mature sequence bmo-miR-31-5p

Accession MIMAT0004213
Previous IDsbmo-miR-31
Sequence

21 - 

ggcaagaagucggcauagcug

 - 41

Get sequence
Deep sequencing17808 reads, 3 experiments
Evidence experimental; Northern [2], cloned [3], RT-PCR [4], Illumina [5]
Database links

Mature sequence bmo-miR-31-3p

Accession MIMAT0015242
Previous IDsbmo-miR-31*
Sequence

58 - 

ggcugugucacuucgagccagc

 - 79

Get sequence
Deep sequencing29 reads, 2 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).