Stem-loop sequence mdo-mir-367

AccessionMI0005375 (change log)
DescriptionMonodelphis domestica miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
   -----           ca     -c      cu 
5'      acuguugcuaa  ugcaa  ucuguu  a
        |||||||||||  |||||  ||||||  u
3'      ugguaacgauu  acguu  gggcaa  g
   gguag           uc     aa      au 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 66074337-66074399 [-]
antisense
ENSMODT00000007165 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from mdo-mir-367
mdo-mir-302bchr5: 66075008-66075078 [-]
mdo-mir-302cchr5: 66074864-66074922 [-]
mdo-mir-302achr5: 66074649-66074718 [-]
mdo-mir-302dchr5: 66074486-66074556 [-]
mdo-mir-367chr5: 66074337-66074399 [-]
Database links

Mature sequence mdo-miR-367

Accession MIMAT0004184
Sequence

38 - 

gaauugcacuuuagcaaugguga

 - 60

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0003531
Predicted targets

References

1