Stem-loop sequence mdo-mir-302d

AccessionMI0005374 (change log)
DescriptionMonodelphis domestica miR-302d stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   --  u u    u          ug    cugugau 
5'   cc c gcuu aacauggaag  cuug       u
     || | |||| ||||||||||  ||||       u
3'   gg g ugag uuguaccuuc  gaau       u
   gu  u u    u          gu    uaaaaaa 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 66074486-66074556 [-]
antisense
ENSMODT00000007165 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from mdo-mir-302d
mdo-mir-302bchr5: 66075008-66075078 [-]
mdo-mir-302cchr5: 66074864-66074922 [-]
mdo-mir-302achr5: 66074649-66074718 [-]
mdo-mir-302dchr5: 66074486-66074556 [-]
mdo-mir-367chr5: 66074337-66074399 [-]
Database links

Mature sequence mdo-miR-302d

Accession MIMAT0004183
Sequence

44 - 

uaagugcuuccauguuugagu

 - 64

Get sequence
Deep sequencing18 reads, 3 experiments
Evidence by similarity; MI0000774
Predicted targets

References

1