Stem-loop sequence mdo-mir-302a

AccessionMI0005373 (change log)
DescriptionMonodelphis domestica miR-302a stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   c   c    u         uu          guu 
5'  cca uacu aaacgugga  uacuugcuuu   u
    ||| |||| |||||||||  ||||||||||   c
3'  ggu guga uuuguaccu  gugaaugaaa   u
   -   a    u         uc          aaa 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 66074649-66074718 [-]
antisense
ENSMODT00000007165 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from mdo-mir-302a
mdo-mir-302bchr5: 66075008-66075078 [-]
mdo-mir-302cchr5: 66074864-66074922 [-]
mdo-mir-302achr5: 66074649-66074718 [-]
mdo-mir-302dchr5: 66074486-66074556 [-]
mdo-mir-367chr5: 66074337-66074399 [-]
Database links

Mature sequence mdo-miR-302a

Accession MIMAT0004182
Sequence

45 - 

uaagugcuuccauguuuuag

 - 64

Get sequence
Deep sequencing24 reads, 3 experiments
Evidence by similarity; MI0000738
Predicted targets

References

1