Stem-loop sequence mdo-mir-302c

AccessionMI0005372 (change log)
DescriptionMonodelphis domestica miR-302c stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   --   uu             c    acgu 
5'   gcu  aacauggggguac ugcu    a
     |||  ||||||||||||| ||||    a
3'   uga  uuguaccuucgug auga    u
   gg   cu             a    aaaa 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 66074864-66074922 [-]
antisense
ENSMODT00000007165 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from mdo-mir-302c
mdo-mir-302bchr5: 66075008-66075078 [-]
mdo-mir-302cchr5: 66074864-66074922 [-]
mdo-mir-302achr5: 66074649-66074718 [-]
mdo-mir-302dchr5: 66074486-66074556 [-]
mdo-mir-367chr5: 66074337-66074399 [-]
Database links

Mature sequence mdo-miR-302c

Accession MIMAT0004181
Sequence

37 - 

uaagugcuuccauguuucagu

 - 57

Get sequence
Deep sequencing17 reads, 3 experiments
Evidence by similarity; MI0000773
Predicted targets

References

1