Stem-loop sequence mdo-mir-93

AccessionMI0005369 (change log)
DescriptionMonodelphis domestica miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   a    ug    g   -ca       -     u    g   u  g u 
5'  gucu  gggg cuc   aagugcu guucg gcag uag gu a a
    ||||  |||| |||   ||||||| ||||| |||| ||| || | a
3'  cagg  cccc gag   uucacga cgagu cguc auc ca u c
   a    gu    -   acc       u     -    -   -  g c 
Get sequence
Deep sequencing
12260 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 257689983-257690071 [+]
sense
ENSMODT00000005328 ; MCM7-201; intron 13
ENSMODT00000042937 ; MCM7-202; intron 14
Clustered miRNAs
< 10kb from mdo-mir-93
mdo-mir-93chr2: 257689983-257690071 [+]
mdo-mir-25chr2: 257690280-257690362 [+]
Database links

Mature sequence mdo-miR-93-5p

Accession MIMAT0004178
Sequence

17 - 

aaagugcuguucgugcagguag

 - 38

Get sequence
Deep sequencing12233 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-93-3p

Accession MIMAT0026715
Sequence

55 - 

acugcugagcuagcacuuccag

 - 76

Get sequence
Deep sequencing27 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).