Stem-loop sequence mdo-mir-27b

AccessionMI0005367 (change log)
DescriptionMonodelphis domestica miR-27b stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   -a   -    gaca                  auug        ucacug 
5'   ccu cucu    aggugcagagcuuagccg    gugaacag      a
     ||| ||||    ||||||||||||||||||    ||||||||      u
3'   gga gaga    uccacgucuugaaucggu    cacuuguu      u
   gg   a    --ag                  --ga        ucuccu 
Get sequence
Deep sequencing
245051 reads, 3.3e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 17696090-17696186 [+]
sense
ENSMODT00000003466 ; C9orf3-201; intron 17
Clustered miRNAs
< 10kb from mdo-mir-27b
mdo-mir-23bchr6: 17695901-17695974 [+]
mdo-mir-27bchr6: 17696090-17696186 [+]
mdo-mir-24-1chr6: 17696508-17696564 [+]
Database links

Mature sequence mdo-miR-27b-5p

Accession MIMAT0026714
Sequence

19 - 

agagcuuagccgauuggugaaca

 - 41

Get sequence
Deep sequencing2644 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-27b-3p

Accession MIMAT0004177
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing242402 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).