Stem-loop sequence mdo-mir-23b

AccessionMI0005366 (change log)
DescriptionMonodelphis domestica miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
         u   --          -  c      gugacu 
5' ggcugc ugg  guuccuggca ug ugauuu      u
   |||||| |||  |||||||||| || ||||||       
3' ccgacg acc  uagggaccgu ac acuaaa      a
         c   au          u  -      aguaga 
Get sequence
Deep sequencing
79596 reads, 940 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 17695901-17695974 [+]
sense
ENSMODT00000003466 ; C9orf3-201; intron 17
Clustered miRNAs
< 10kb from mdo-mir-23b
mdo-mir-23bchr6: 17695901-17695974 [+]
mdo-mir-27bchr6: 17696090-17696186 [+]
mdo-mir-24-1chr6: 17696508-17696564 [+]
Database links

Mature sequence mdo-miR-23b-5p

Accession MIMAT0026713
Sequence

9 - 

ggguuccuggcaugcugauuu

 - 29

Get sequence
Deep sequencing394 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-23b-3p

Accession MIMAT0004176
Sequence

46 - 

aucacauugccagggauuacc

 - 66

Get sequence
Deep sequencing79194 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).