Stem-loop sequence mdo-mir-24-2

AccessionMI0005365 (change log)
DescriptionMonodelphis domestica miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   -gc       g   a         aaca     --g u 
5'    cuccugu ccu cugagcuga    caguu   c u
      ||||||| ||| |||||||||    |||||   |  
3'    gaggaca gga gacuugacu    gucaa   g u
   ucu       a   c         --cg     aua g 
Get sequence
Deep sequencing
237714 reads, 3.16e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 446526144-446526216 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-24-2
mdo-mir-23achr3: 446525826-446525898 [+]
mdo-mir-27achr3: 446525995-446526080 [+]
mdo-mir-24-2chr3: 446526144-446526216 [+]
Database links

Mature sequence mdo-miR-24-5p

Accession MIMAT0026712
Sequence

8 - 

gugccuacugagcugaaacacagu

 - 31

Get sequence
Deep sequencing1038 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-24-3p

Accession MIMAT0004175
Sequence

46 - 

uggcucaguucagcag

 - 61

Get sequence
Deep sequencing237105 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).